Quick Order

Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FKBP1AcDNA Clone Product Information
cDNA Size:327
cDNA Description:ORF Clone of Mus musculus FK506 binding protein 1a DNA.
Gene Synonym:Fkbp, 12kDa, Fkbp1, FKBP12, mFKBP1, mFKBP12, FKBP12-T1, FKBP12-T2, Fkbp1a
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50265-ACG$325
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50265-ACR$325
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50265-ANG$325
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50265-ANR$325
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50265-CF$295
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50265-CH$295
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50265-CM$295
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50265-CY$295
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone)MG50265-M$95
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50265-NF$295
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50265-NH$295
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50265-NM$295
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50265-NY$295
Mouse FKBP1A / FKBP12 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50265-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

FK506 binding protein 12 (FKBP12), also known as FKBP1, along with cyclophilin, are two major members of the immunophilin protein family who serve as receptors for the immunosuppressant drugs cyclosporin A and FK506. As a conserved molecules in many eukaryotes, FKBP12 has been characterized as a peptidyl-prolyl isomerase that catalyzes the transition between cis- and trans-proline residues, and is involved in several biochemical processes including protein folding, receptor signaling, protein trafficking and transcription. FKBP12 has attracted immense attention and its role in mediating the immunosuppressive functions. FKBP12 serves a dual role as a peptidyl-prolyl cis-trans isomerase and as a modulator of several cell signaling pathways. In one such a role, FKBP12 interacts with and regulates the functional state of the ryanodine Ca2+ channel receptor by altering protein conformation and coordinating multi-protein complex formation. Another physiological role of FKBP12 is an interactor and a regulator of the type I serine/threonine kinase receptors of TGF-beta superfamily. Current data, derived from detailed biochemical studies as well as from functional studies in various systems, suggest that FKBP12 functions as a "guardian" for the type I receptors to prevent them from leaky signaling under sub-optimal ligand concentrations, thereby providing a molecular "gradient reader" for TGF-beta family morphogens. This aspect of FKBP12 function may be critical for cellular responsiveness to morphogenetic gradients of the TGF-beta family members during early development, serving to assure the translation of different ligand concentrations into different signaling readouts. In addition, FKBP12 may be involved in neuronal or astrocytic cytoskeletal organization and in the abnormal metabolism of tau protein in Alzheimer's disease (AD) damaged neurons.

  • Wang T, et al. (2004) The immunophilin FKBP12: a molecular guardian of the TGF-beta family type I receptors. Front Biosci. 9: 619-31.
  • Sugata H, et al. (2009) A peptidyl-prolyl isomerase, FKBP12, accumulates in Alzheimer neurofibrillary tangles. Neurosci Lett. 459(2): 96-9.
  • Brath U, et al. (2009) Differential responses of the backbone and side-chain conformational dynamics in FKBP12 upon binding the transition-state analog FK506: implications for transition-state stabilization and target protein recognition. J Mol Biol. 387(1): 233-44.
  • Scaramello CB, et al.. (2009) FKBP12 depletion leads to loss of sarcoplasmic reticulum Ca(2+) stores in rat vas deferens. J Pharmacol Sci. 109(2): 185-92.