Quick Order

Text Size:AAA

Rat KIRREL3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KIRREL3cDNA Clone Product Information
cDNA Size:2301
cDNA Description:ORF Clone of Rattus norvegicus kin of IRRE like 3 (Drosophila) DNA.
Gene Synonym:Kirrel3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Kin of IRRE-like protein 3 (KIRREL3) also known as nin of irregular chiasm-like protein 3 or nephrin-like protein 2 (NEPH2) is a member of the nephrin-like protein family of transmembrane proteins, which includes NEPH1 (KIRREL) and NEPH3 (KIRREL2). KIRREL3/NEPH2 is expressed in fetalv and adult brain, and also in podocytes of kidney glomeruli. The cytoplasmic domains of KIRREL3/NEPH2 interact with the C-terminus of podocin, also expressed in the podocytes, cells involved in ensuring size- and charge-selective ultrafiltration. Mutations in KIRREL3/NEPH2 are associated with mental retardation autosomal dominant type 4. KIRREL3/NEPH2 expression is turned on in migrating nucleogenesis of the pontine nucleus (PN) neurons only after they enter the presumptive nuclear region. KIRREL3/NEPH2 knockdown disrupted the nuclear organization of PN presumably by changing the migratory behavior of PN neurons inside the nuclear region. Moreover, overexpression of the cytoplasmic region of KIRREL3, which can sequester intracellular signaling of endogenous KIRREL3, resulted in similar phenotypes. Overall, these results suggest KIRREL3 is involved in the nucleogenesis of the PN through the control of neuronal migration inside the nucleus.

  • Bhalla K, et al. (2008) Alterations in CDH15 and KIRREL3 in patients with mild to severe intellectual disability. Am J Hum Genet. 83(6): 703-13.
  • Gerke P, et al. (2005) NEPH2 is located at the glomerular slit diaphragm, interacts with nephrin and is cleaved from podocytes by metalloproteinases. J Am Soc Nephrol. 16(6): 1693-702.
  • Gerke P, et al. (2006) Neuronal expression and interaction with the synaptic protein CASK suggest a role for Neph1 and Neph2 in synaptogenesis. J Comp Neurol. 498(4): 466-75.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items