Quick Order

Text Size:AAA

Rat CLEC4D Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC4DcDNA Clone Product Information
Gene_bank_ref_id:NM_001003707.1
cDNA Size:657
cDNA Description:ORF Clone of Rattus norvegicus C-type lectin domain family 4, member D DNA.
Gene Synonym:Mcl, Clecsf8, Clec4d
Species:Rat
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

C-type lectin (CLEC) family is a type of carbohydrate-binding protein domain named lectin. C-type lectins are the most diverse and prevalent lectin family in immunity with its requirement for calcium for binding. Proteins including a C-type lectin domain have diverse range of functions including cell-cell adhesion, immune response to pathogens and apoptosis. There are at least 14 types of C-type lectins: typeⅠto typeⅩⅣ. CLEC4D(CLECSF8) is a typeⅡ membrane glycoprotein belonging to the C-type lectin family, with restricted expression in the monocyte/macrophage lineage. It plays important roles in the function of macrophages.

References
  • Johnson KD, et al. (2007) Friend of GATA-1-independent Transcriptional Repression: A Novel Mode of GATA-1 Function. Blood. 109 (12): 5230-3.
  • Arce I, et al. (2004) The human C-type lectin CLECSF8 is a novel monocyte/macrophage endocytic receptor. Eur J Immunol. 34 (1): 210-20.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36 (8): 2159-69.
  • Size / Price
    Catalog:RG80213-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"