Quick Order

Text Size:AAA

Mouse GP1bb Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GP1BBcDNA Clone Product Information
cDNA Size:645
cDNA Description:ORF Clone of Mus musculus glycoprotein Ib, beta polypeptide DNA.
Gene Synonym:Gp1bb
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Platelet glycoprotein Ib (GPIb) complex is best known as a major platelet receptor for von Willebrand factor essential for platelet adhesion under high shear conditions found in arteries and in thrombosis. The GPIb complex is composed of GPIb alpha (Platelet glycoprotein Ib alpha chain) covalently attached to GPIb beta (Platelet glycoprotein Ib beta chain) and noncovalently complexed with GPIX and GPV. GPIb-beta, also known as GP1BB, CD42b-beta and CD42c, is single-pass type I membrane protein expressed in heart and brain, which is a critical component of the von Willebrand factor (vWF) receptor. The cysteine knot region of GPIb beta in the N terminus is critical for the conformation of GPIb beta that interacts with GPIX. The precursor of GP1BB is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. GPIb is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. GPIb alpha chain provides the vWF binding site, and GPIb beta chain contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. GP1BB is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (vWF), and mediates platelet adhesion in the arterial circulation. Defects in GP1BB are a cause of Bernard-Soulier syndrome (BSS), also known as giant platelet disease (GPD). BSS patients have unusually large platelets and have a clinical bleeding tendency.

  • Kenny D, et al. (2002) The cysteine knot of platelet glycoprotein Ib beta (GPIb beta) is critical for the interaction of GPIb beta with GPIX. Blood. 99(12): 4428-33.
  • Tang J,et al. (2004) Mutation in the leucine-rich repeat C-flanking region of platelet glycoprotein Ib beta impairs assembly of von Willebrand factor receptor. Thromb Haemost. 92(1): 75-88.
  • Vanhoorelbeke K, et al. (2007) Inhibition of platelet glycoprotein Ib and its antithrombotic potential. Curr Pharm Des. 13(26): 2684-97.
  • Clemetson KJ, et al. (2008) Platelet GPIb complex as a target for anti-thrombotic drug development. Thromb Haemost. 99(3): 473-9.