After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse NT5E ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse NT5E cDNA Clone Product Information
Gene_bank_ref_id:NM_011851.3
RefSeq ORF Size:1731bp
cDNA Description:Full length Clone DNA of Mus musculus 5' nucleotidase, ecto with C terminal HA tag.
Gene Synonym:NT, Nt5, eNT, CD73, AI447961, 2210401F01Rik, Nt5e
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein which belongs to the 5'-nucleotidase family. CD73 is a glycosyl phosphatidylinositol (GPI) anchored purine salvage enzyme expressed on the surface of human T and B lymphocytes. CD73 catalyzes the conversion of purine and pyrimidine ribo- and deoxyribonucleoside monophosphates to the corresponding nucleosides. CD73 serves as a costimulatory molecule in activating T cells. CD73 generated adenosine functions in cell signalling in many physiologic systems, including intestinal epithelium, ischemic myocardium, and cholinergic synapses. CD73 might mediate lymphocyte-stromal cell interactions or condition the local microenvironment to facilitate lymphocyte development and/or function. In CD73-depleted cells, surface levels of the leukocyte adhesion molecules ICAM-1, VCAM-1 and E-selectin increase. CD73 produces extracellular adenosine, which then acts on G protein-coupled purigenic receptors to induce cellular responses. CD73 has also been reported to regulate expression of pro-inflammatory molecules in mouse endothelium.

References
  • Resta R. et al., 1997, Cell Signal. 9 (2): 131-9.
  • Yamashita Y. et al., 1998, Eur J Immunol. 28 (10): 2981-90.
  • Louis NA. et al., 2008, J Immunol. 180 (6): 4246-55.
  • Grünewald JK. et al., 2010, J Inflamm. 7 (1): 10.
  • Size / Price
    Catalog: MG50231-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"