After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse FLRT2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FLRT2cDNA Clone Product Information
Gene_bank_ref_id:NM_201518.4
cDNA Size:1983
cDNA Description:ORF Clone of Mus musculus fibronectin leucine rich transmembrane protein 2 DNA.
Gene Synonym:KIAA0405, Flrt2
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Fibronectin Leucine-Rich Transmembrane (FLRT) proteins are glycosylated membrane proteins expressed at the cell surface which localise in a homophilic manner to cell-cell contacts expressing the focal adhesion marker vinculin. FLRT1, FLRT2, and FLRT3, the three genes encode putative type I transmembrane proteins, each containing 10 leucine-rich repeats (LRR), a type III fibronectin (FN) domain, followed by the transmembrane region, and a short cytoplasmic tail. FLRT family members may function in cell adhesion and/or receptor signalling. Each member of the FLRT family has a distinct, highly regulated expression pattern, as was seen for the NLRR family. FLRT2 is expressed in a subset of the sclerotome, adjacent to the region that forms the syndetome, suggesting that interaction with FGF signalling may be a general property of FLRT proteins. All FLRTs can interact with FGFR1 and FLRTs can be induced by the activation of FGF signalling by FGF-2. FLRT proteins have a dual role, promoting FGF signalling and modulating homotypic cell adhesion. FLRT2 played critical roles in craniofacial development, and it was also present in the vomero-nasal organ, mandibular primodia, and the posterior aspects of the unfused and fused secondary palatal shelves.

References
  • Lacy SE, et al. (1999) Identification of FLRT1, FLRT2, and FLRT3: a novel family of transmembrane leucine-rich repeat proteins. Genomics. 62(3): 417-26.
  • Haines BP, et al. (2006) Regulated expression of FLRT genes implies a functional role in the regulation of FGF signalling during mouse development. Dev Biol. 297(1): 14-25.
  • Karaulanov EE, et al. (2006) A role for fibronectin-leucine-rich transmembrane cell-surface proteins in homotypic cell adhesion. EMBO Rep. 7(3): 283-90.
  • Maretto S, et al. (2008) Ventral closure, headfold fusion and definitive endoderm migration defects in mouse embryos lacking the fibronectin leucine-rich transmembrane protein FLRT3. Dev Biol. 318(1): 184-93.
  • Gong SG, et al. (2009) Flrt2 and Flrt3 have overlapping and non-overlapping expression during craniofacial development. Gene Expr Patterns. 9(7): 497-502.
  • Size / Price
    Catalog:MG51074-NH
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"