After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse IL24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL24cDNA Clone Product Information
cDNA Size:546
cDNA Description:ORF Clone of Mus musculus interleukin 24 DNA.
Gene Synonym:FISP, Mda7, St16, Mda-7
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

IL-10 Family & Receptor Related Products

Interleukin-24 (IL-24) also known as Melanoma differentiation-associated gene 7 protein (MDA-7) is a member of the IL10 family of cytokines. IL-24/MDA-7/IL24 can induce apoptosis selectively in various cancer cells. Overexpression of IL-24 leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Human IL-24/MDA-7/IL24 is secreted by activated peripheral blood mononuclear cells and is the ligand for two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. Northern blot analysis revealed IL-24/MDA-7/IL24 expression in human tissues associated with the immune system such as spleen, thymus, peripheral blood leukocytes and normal melanocytes. IL-24/MDA-7/IL24 binding to either its endogenous receptors on human keratinocytes or to ectopically expressed receptors on baby hamster kidney cells leads to activation of the signal transducers and activators of transcription.

  • Wang M, et al.. (2002) Interleukin 24 (MDA-7/MOB-5) signals through two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. J Biol Chem. 277(9): 7341-7.
  • Sauane M, et al.. (2003) MDA-7/IL-24: novel cancer growth suppressing and apoptosis inducing cytokine. Cytokine Growth Factor Rev. 14(1): 35-51.
  • Sarkar D, et al.. (2002) mda-7 (IL-24) Mediates selective apoptosis in human melanoma cells by inducing the coordinated overexpression of the GADD family of genes by means of p38 MAPK. Proc Natl Acad Sci U S A. 99(15): 10054-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items