After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat HFE2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HFE2cDNA Clone Product Information
cDNA Size:1269
cDNA Description:ORF Clone of Rattus norvegicus hemochromatosis type 2 (juvenile) homolog (human) DNA.
Gene Synonym:Rgmc, MGC105910, Hfe2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Hemojuvelin, also known as HFE2, is a membrane-bound and soluble protein which belongs to the repulsive guidance molecule (RGM) family. It is known that RGMs function through Neogenin, a homologue of the Netrin receptor deleted in colon cancer. In mammals, RGM family consists of three glycoproteins which have discrete expression patterns and functions (RGM-A, RGM-B, and RGM-C). Hemojuvelin is expressed in adult and fetal liver, heart, and skeletal muscle. Hemojuvelin acts as a bone morphogenetic protein (BMP) coreceptor. Enhancement of BMP signaling regulates hepcidin (HAMP) expression and iron metabolism. It plays a key role in iron metabolism. Hemojuvelin represents the cellular receptor for hepcidin. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. Defects in hemojuvelin are the cause of hemochromatosis type 2A, also known as juvenile hemochromatosis (JH).

  • Papanikolaou G, et al. (2004) Mutations in HFE2 cause iron overload in chromosome 1q-linked juvenile hemochromatosis. Nat Genet. 36(1):77-82.
  • Babitt JL, et al. (2006) Bone morphogenetic protein signaling by hemojuvelin regulates hepcidin expression. Nat Genet. 38(5):531-9.
  • Zhang AS, et al. (2008) Neogenin-mediated hemojuvelin shedding occurs after hemojuvelin traffics to the plasma membrane. J Biol Chem. 283(25):17494-502.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items