After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse MCPT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MCPT1cDNA Clone Product Information
cDNA Size:675
cDNA Description:ORF Clone of Mus musculus mast cell protease 1 DNA.
Gene Synonym:Mcp-1, AV080368, Mcpt1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Mouse Mast Cell Protease 1 (MMCP-1), also known as MCP-1, MCPT-1 and β-chymase, is a member of the Chymase family of chymotrypsin-like serine proteases. MCPT-1 is a 26 kDa β-chymase that is a component of mast cell granules. It is a 226 amino acid (aa) protein that has a conserved pattern of six cysteines and one potential glycosylation site. The granule-derived mouse mast cell proteases-1 and -2 (mMCP-1 and -2) colocalize in similar quantities in mucosal mast cells but micrograms of mMCP-1 compared with nanograms of mMCP-2 are detected in peripheral blood during intestinal nematode infection. mMCP-1 isolated from serum is complexed with serpins and both the accumulation and the longevity of mMCP-1 in blood is due to complex formation, protecting it from a pathway that rapidly clears mMCP-2, which is unable to form complexes with serpins. The mucosal mast cell (MMC) granule-specific beta-chymase, mouse mast cell protease-1 (mMCP-1), is released systemically into the bloodstream early in nematode infection before parasite-specific IgE responses develop and TGF-beta1 induces constitutive release of mMCP-1 by homologues of MMC in vitro. Expression of mMCP-1 is largely restricted to intraepithelial MMC and is thought to play a role in the regulation of epithelial permeability. Its activation is completed by the removal of a two residue N-terminal propeptide by a dipeptidyl peptidase (Cathepsin C). MCPT-1 is upregulated in the intestine in response to nematode infection, or in systemic mucosa in response to anaphylaxis. Like human α-chymase, MCPT-1 is capable of the conversion of angiotensin I to angiotensin II, which plays a key role in the regulation of arterial pressure. The intestinal inflammation associated with gastrointestinal helminths is partly mediated by mMCP-1.

  • Pemberton AD, et al. (2003) Purification and characterization of mouse mast cell proteinase-2 and the differential expression and release of mouse mast cell proteinase-1 and -2 in vivo. Clin Exp Allergy. 33(7): 1005-12.
  • Brown JK, et al. (2003) Constitutive secretion of the granule chymase mouse mast cell protease-1 and the chemokine, CCL2, by mucosal mast cell homologues. Clin Exp Allergy. 33(1): 132-46.
  • Lawrence CE, et al. (2004) Mouse mast cell protease-1 is required for the enteropathy induced by gastrointestinal helminth infection in the mouse. Gastroenterology. 127(1): 155-65.
  • Pemberton AD, et al. (2006) Anaphylactic release of mucosal mast cell granule proteases: role of serpins in the differential clearance of mouse mast cell proteases-1 and -2. J Immunol. 176(2): 899-904.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items