Quick Order

Mouse CPE Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CPEcDNA Clone Product Information
cDNA Size:1431
cDNA Description:ORF Clone of Mus musculus Carboxypeptidase E DNA.
Gene Synonym:CPH, fat, Cph1, Cph-1, R74677, MGC7101, Cpe
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Human carboxypeptidase E (CPE), also known as Carboxypeptidase H, is a peripheral membrane protein and a zinc metallocarboxypeptidase, and the conversion of proCPE into CPE occurs primarily in secretory vesicles. The active form of CPE cleaves C-terminal amino acid residues of the peptide, and is thus involved in the biosynthesis of peptide hormones and neurotransmitters including insulin, enkephalin, etc. The enzymatic activity is enhanced by millimolar concentrations of Co2+. It has also been proposed that membrane-associated carboxypeptidase E acts as a sorting receptor for targeting regulated secretory proteins which are mostly prohormones and neuropeptides in the trans-Golgi network of the pituitary and in secretory granules into the secretory pathway.Its interaction with glycosphingolipid-cholesterol rafts at the TGN facilitates the targeting. Mutations in this gene are implicated in type I I diabetes due to impaired glucose clearance and insulin resistance.

  • Manser, E. et al., 1990, Biochem. J. 267: 517-525.
  • Cool, D.R. et al., 1997, Cell. 88: 73-83.
  • Song, L. and Fricker, L. 1995, J. Neurochem. 65: 444-453.
  • Dhanvantari,S. et al., 2000, J. Biol. Chem. 275: 29887-29893.
  • Jeffrey, K.D. et al., 2008, Proc. Natl. Acad. Sci. U.S.A. 105: 8452-8457
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items