Quick Order

Text Size:AAA

Mouse PSMA / FOLH1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FOLH1cDNA Clone Product Information
cDNA Size:2259
cDNA Description:ORF Clone of Mus musculus folate hydrolase DNA.
Gene Synonym:mopsm, MGC141397, Folh1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Glutamate carboxypeptidase 2, also known as Glutamate carboxypeptidase II, Membrane glutamate carboxypeptidase, Prostate-specific membrane antigen, GCPII, PSMA, FOLH1, and NAALAD1, is a single-pass type I I membrane protein which belongs to the peptidase M28 family and M28B subfamily. FOLH1 is highly expressed in prostate epithelium. It is detected in urinary bladder, kidney, testis, ovary, fallopian tube, breast, adrenal gland, liver, esophagus, stomach, small intestine, colon, brain (at protein level), and the capillary endothelium of a variety of tumors. FOLH1 has both folate hydrolase and N-acetylated alpha linked acidic dipeptidase (NAALADase) activity. It has a preference for tri-alpha-glutamate peptides. Genetic variation in FOLH1 may be associated with low folate levels and consequent hyperhomocysteinemia. This condition can result in increased risk of cardiovascular disease, neural tube defects, and cognitive deficits. FOLH1 also shows a promising role in directed imaging and therapy of recurrent or metastatic disease.