After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse PRMT6 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PRMT6 cDNA Clone Product Information
Gene_bank_ref_id:NM_178891.4
RefSeq ORF Size:1137bp
cDNA Description:Full length Clone DNA of Mus musculus protein arginine N-methyltransferase 6 with N terminal His tag.
Gene Synonym:Hrmt1l6, AW124876, BB233495, Prmt6
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Protein arginine N-methyltransferase 6, also known as Histone-arginine N-methyltransferase PRMT6, PRMT6, and HRMT1L6, is a member of the protein arginine N-methyltransferase family and PRMT6 subfamily. PRMT6 is highly expressed in kidney and testes. PRMT6 is known to catalyze the generation of asymmetric dimethylarginine in polypeptides. It has been implicated in human immunodeficiency virus pathogenesis, DNA repair, and transcriptional regulation. PRMT6 is known to methylate histone H3 Arg-2 (H3R2), and this negatively regulates the lysine methylation of H3K4 resulting in gene repression. PRMT6 plays a key role in coupling process by functioning as a transcriptional coactivator that can regulate alternative splicing. PRMT6 coactivates the progesterone, glucocorticoid and oestrogen receptors in luciferase reporter assays in a hormone-dependent manner. Small interfering RNA (siRNA) oligonucleotide duplex knockdown of PRMT6 disrupts oestrogen-stimulated transcription of endogenous GREB1 and progesterone receptor in MCF-7 breast cancer cells. Neutralizing the activity of PRMT6 could inhibit tumor progression and may be of cancer therapeutic significance.

References
  • Hyllus D, et al., 2007, Genes Dev. 21(24): 3369-80.
  • Lakowski, TM. et al., 2008, J Biol Chem. 283 (15): 10015-25. 
  • Michaud-Levesque, J. et al., 2009, J Biol Chem. 284 (32): 21338-46.
  • Harrison, MJ. et al., 2010, Nucleic acids Res. Jan 4.
  • Size / Price
    Catalog: MG51052-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"