Quick Order

Rat VEGFB Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
VEGFBcDNA Clone Product Information
Gene_bank_ref_id:NM_053549.1
cDNA Size:561
cDNA Description:ORF Clone of Rattus norvegicus vascular endothelial growth factor B DNA.
Gene Synonym:Vegfb
Species:Rat
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Vascular Endothelial Growth Factor (VEGF) & Receptor Related Products
Product nameProduct name
Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 ProteinHuman VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGF121 / VEGF-A ProteinHuman Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human Neuropilin 2 / NRP2 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGF-B / VEGFB Protein (Fc Tag)Human VEGF121 / VEGF-A ProteinHuman VEGF121b / VEGF-A ProteinMouse PIGF / PLGF Protein (Fc Tag)Mouse PIGF / PLGF ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Mouse VEGF-D / VEGFD / FIGF Protein (His Tag)Mouse VEGFA / VEGF164 ProteinMouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Danio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinCanine VEGF / VEGFA ProteinRat VEGF164 / VEGFA ProteinRat VEGFR1 / FLT-1 Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)
Size / Price
Catalog:RG80114-NM
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"