Quick Order

Mouse CREG1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CREG1 cDNA Clone Product Information
Gene_bank_ref_id:NM_011804.2
RefSeq ORF Size:663bp
cDNA Description:Full length Clone DNA of Mus musculus cellular repressor of E1A-stimulated genes 1 with N terminal His tag.
Gene Synonym:Creg, AA755314, Creg1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CREG1 belongs to the CREG family. It is a adenovirus E1A protein which both activates and represses gene expression to promote cellular proliferation and inhibit differentiation. Thus it may contribute to the transcriptional control of cell growth and differentiation. The transcriptional control activity of cell growth requires interaction with IGF2R. CREG1 also antagonizes transcriptional activation and cellular transformation by E1A. It shares limited sequence similarity with E1A and binds both the general transcription factor TBP and the tumor suppressor pRb in vitro. CREG1 gene may contribute to the transcriptional control of cell growth and differentiation.

References
  • Veal E, et al. (2000) The secreted glycoprotein CREG enhances differentiation of NTERA-2 human embryonal carcinoma cells. Oncogene. 19(17):2120-8.
  • Wen SJ, et al. (2003) Screening the proteins that interact with calpain in a human heart cDNA library using a yeast two-hybrid system. Hypertens Res. 25(4):647-52.
  • Grouse LH, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    Catalog: MG51049-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"