Quick Order

Text Size:AAA

Rat PGC Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PGCcDNA Clone Product Information
cDNA Size:1179
cDNA Description:ORF Clone of Rattus norvegicus progastricsin (pepsinogen C) DNA.
Gene Synonym:PG1, Pg-1, Upg1, Pgc
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Pepsinogen C, also known as PGC, is an aspartic proteinase that belongs to the peptidase family A1. Pepsinogen C is synthesized in the gastric mucosa as inactive precursors, known as zymogens. Pepsinogen C contains a prosegment that serves to stabilize the inactive form and prevent entry of the substrate to the active site. At low PH conditions, Pepsinogen C undergoes conversion into active enzyme. Pepsinogen C has been found expressed in all regions of the stomach mucosa and also in the proximal duodenal mucosa. In stomach cancer tissues and cancer cell lines, the expressions of the pepsinogen genes were decreased or lost, in good accordance with their pepsinogen productions. No gross structural changes of the pepsinogen genes were observed in these cancers, but the methylation patterns of the pepsinogen genes were found to be altered in different ways in different cancers. Serum levels of Pepsinogen C are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis.

  • Richter C, et al. (1998) Mechanism of activation of the gastric aspartic proteinases: pepsinogen, progastricsin and prochymosin. Biochem J. 1 (335): 481-90.
  • Westerveld BD, et al. (1987) Gastric proteases in Barrett's esophagus. Gastroenterology. 93 (4): 774-8.
  • Ichinose M, et al. (1991) Methylation and expression of human pepsinogen genes in normal tissues and their alteration in stomach cancer. Jpn J Cancer Res. 82 (6): 686-92.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks