Quick Order

Text Size:AAA

Rat CD31 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat PECAM1 cDNA Clone Product Information
Gene_bank_ref_id:NM_031591.1
RefSeq ORF Size:2037bp
cDNA Description:Full length Clone DNA of Rattus norvegicus platelet/endothelial cell adhesion molecule 1 with N terminal Myc tag.
Gene Synonym:CD31, Pecam, MGC124998, Pecam1
Species:Rat
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

The Cluster of Differentiation 31 (CD31) adhesion molecule, also known as platelet-endothelial cell adhesion molecule-1 (PECAM-1), is the only known member of the CAM family on platelets. CD31 protein is a 130-kDa transmembrane glycoprotein expressed by endothelial cells, platelets, monocytes, neutrophils, and certain T cell subsets. CD31 protein is also expressed in certain tumors, including epithelioid hemangioendothelioma, other vascular tumors, and histiocytic malignancies. CD31 plays a key role in removing aged neutrophils and tissue regeneration. CD31 protein mediates the homotypic or heterotypic cell adhesion by binding to itself or the leukocyte integrin αvβ3, and thus plays a role in neutrophil recruitment in inflammatory responses, transendothelial migration of leukocytes, as well as in cardiovascular development.

References
  • Deaglio S, et al. (2000) CD38/CD31, a receptor/ligand system ruling adhesion and signaling in human leukocytes. Chem Immunol. 75: 99-120.
  • Kohler S, et al. (2009) Life after the thymus: CD31+ and CD31- human naive CD4+ T-cell subsets. Blood. 113(4): 769-74.
  • Size / Price
    Catalog: RG80091-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"