After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat YWHAE Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
YWHAEcDNA Clone Product Information
cDNA Size:768
cDNA Description:ORF Clone of Rattus norvegicus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide DNA.
Gene Synonym:14-3-3e, Ywhae
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

YWHAE, also known as 14-3-3 epsilon, mediate signal transduction by binding to phosphoserine-containing proteins. 14-3-3 epsilon / YWHAE is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 epsilon / YWHAE is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. YWHAE interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 epsilon / YWHAE is implicated in the regulation of a large spectrum of both general and specialized signaling pathways. 14-3-3 epsilon / YWHAE Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. This Binding generally results in the modulation of the activity of the binding partner.

  • Ikeda M, et al. (2008) Identification of YWHAE, a gene encoding 14-3-3epsilon, as a possible susceptibility gene for schizophrenia. Hum Mol Genet. 17(20): 3212-22.
  • Mignon-Ravix C, et al. (2010) Deletion of YWHAE in a patient with periventricular heterotopias and pronounced corpus callosum hypoplasia. J Med Genet. 47(2): 132-6.
  • Nagamani SC, et al. (2009) Microdeletions including YWHAE in the Miller-Dieker syndrome region on chromosome 17p13.3 result in facial dysmorphisms, growth restriction, and cognitive impairment. J Med Genet. 46(12): 825-33.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items