Quick Order

Text Size:AAA

Mouse VSIG4 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse VSIG4 cDNA Clone Product Information
Gene_bank_ref_id:NM_177789.4
RefSeq ORF Size:843bp
cDNA Description:Full length Clone DNA of Mus musculus V-set and immunoglobulin domain containing 4 with C terminal HA tag.
Gene Synonym:CRIg, Z39IG, BC025105, MGC36211, A530061A11, Vsig4
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

VSIG4 (V-set and immunoglobulin domain containing 4), also known as complement receptor of the immunoglobulin superfamily (CRIg) and Z39Ig, is a type I  transmembrane glycoprotein. It is a B7 family-related protein and an Ig superfamily member. In contrast to the B7 family members which contain two IgG domains, VSIG4 contains one complete V-type I g domain and a truncated C-type I g domain. VSIG4 is exclusively expressed on tissue resident macrophages and binds to multimers of C3b and iC3b that are covalently attached to particle surfaces. No VSIG4 expression appears to be present in T and B cells. VSIG4 functions as a negative regulator of T cell activation, and may be involved in the maintenance of peripheral T cell tolerance, and is also identified as a potent suppressor of established inflammation. Mouse VSIG4 is synthesized as a 280 amino acid precursor that contains a signal sequence, an V-type I g domain (aa 36-115), one potential N-linked glycosylation site, and a single transmembrane domain. The V-type I g domain of mouse VSIG4 shares 86% and 80% aa sequence identity with the V-type I g domains of rat and human VSIG4, respectively.

References
  • Vogt, L. et al., 2006, J Clin Invest.116: 2817-2826.
  • Helmy, K. et al., 2006, Cell. 124:915-927.
  • Wiesmann, C. et al., 2006, Nature. 444:217-220.
  • Zang,X. et al., 2006, J Clin Invest. 116: 2590-2593.
  • Katschke, KJ. et al., 2007, J. Exp. Med. 204:1319-1325.
  • He,JQ. et al., 2008, Mol Immunol. 45: 4041-4047.
  • Size / Price
    Catalog: MG50187-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"