After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
WNV WNV-NS3 cDNA Clone Product Information
Gene_bank_ref_id:DQ211652.1
RefSeq ORF Size:1857bp
cDNA Description:Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 with C terminal Flag tag.
Gene Synonym:WNV-NS3
Species:WNV
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence DQ211652.1 (4612..6468), corresponding to amino acid sequence YP_001527884.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-GFPSpark tagVG40347-ACG$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40347-ACR$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-GFPSpark tagVG40347-ANG$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40347-ANR$345
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40347-CF$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-His tagVG40347-CH$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-Myc tagVG40347-CM$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, C-HA tagVG40347-CY$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid (Codon Optimized)VG40347-G$195
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-Flag tagVG40347-NF$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-His tagVG40347-NH$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-Myc tagVG40347-NM$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 ORF mammalian expression plasmid, N-HA tagVG40347-NY$315
West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS3 natural ORF mammalian expression plasmidVG40347-UT$315
 Learn more about expression Vectors
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"