Quick Order

Text Size:AAA

Rift Valley fever virus (RVFV) (strain MP12) NSs Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RVFV RVFV-NSs cDNA Clone Product Information
Gene_bank_ref_id:DQ380154.1
RefSeq ORF Size:798bp
cDNA Description:Full length Clone DNA of Rift Valley fever virus (RVFV) (strain MP12) NSs with C terminal Flag tag.
Gene Synonym:RVFV-NSs
Species:RVFV
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rift Valley fever virus (RVFV) (strain MP12) NSs Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-GFPSpark tagVG40339-ACG$325
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40339-ACR$325
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-GFPSpark tagVG40339-ANG$325
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40339-ANR$325
Rift Valley fever virus (RVFV) (strain MP12) NSs Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40339-CF$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-His tagVG40339-CH$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-Myc tagVG40339-CM$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, C-HA tagVG40339-CY$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid (Codon Optimized)VG40339-G$95
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-Flag tagVG40339-NF$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-His tagVG40339-NH$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-Myc tagVG40339-NM$295
Rift Valley fever virus (RVFV) (strain MP12) NSs ORF mammalian expression plasmid, N-HA tagVG40339-NY$295
Rift Valley fever virus (RVFV) (strain MP12) NSs natural ORF mammalian expression plasmidVG40339-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40339-CF
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"