Quick Order

Text Size:AAA

Mouse TWSG1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TWSG1 cDNA Clone Product Information
Gene_bank_ref_id:NM_023053.2
RefSeq ORF Size:669bp
cDNA Description:Full length Clone DNA of Mus musculus twisted gastrulation homolog 1 (Drosophila) with C terminal HA tag.
Gene Synonym:Tsg, Twg, AW552143, D17Ertd403e, 1810013J15Rik, 9030422N06Rik, Twsg1
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

TWSG1 belongs to the twisted gastrulation protein family. TWSG1 from different species are functionally equivalent. In contrast to Drosophila where TWSG1 expression is limited to early embryos, expression of TWSG1 is found throughout mouse and human development. Mutations in the TWSG1 gene cause at least some of the cells on the dorsal half of the embryo to adopt more ventral cell fates. This is thought to involve gradients of the signaling molecule decapentaplegic. TWSG1 may function as a bone morphogenetic protein signalling agonist or antagonize these activities. It can dislodge latent bone morphogenetic proteins and thus provides a permissive signal that allows high BMP signaling in the embryo. TWSG1 is a cofactor in the antagonism of chordin to BMP signaling. It also binds both the vertebrate Decapentaplegic ortholog BMP4 and chordin and forms ternary complexes. Meanwhile, TWSG1 increases binding of chordin to BMP4, potentiates the ability of chordin to induce secondary axes in Xenopus embryos, and enhances chordin cleavage by vertebrate proteases related to tolloid at a site poorly used in the absence of TWSG1. The presence of TWSG1 enhances the secondary axis-inducing activity of 2 products of chordin cleavage.

References
  • Tzachanis D, et al. (2007) Twisted gastrulation (Tsg) is regulated by Tob and enhances TGF-beta signaling in activated T lymphocytes. J Immunol. Blood. 109 (7): 2944-52.
  • Tanno T, et al. (2009) Identification of TWSG1 as a second novel erythroid regulator of hepcidin expression in murine and human cells. Blood. 114 (1): 181-6.
  • Kauvar EF, et al. (2011) Minimal evidence for a direct involvement of twisted gastrulation homolog 1 (TWSG1) gene in human holoprosencephaly. Mol Genet Metab. 102 (4): 470-80.
  • Size / Price
    Catalog: MG50162-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"