After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EBOV-GcDNA Clone Product Information
Gene_bank_ref_id:U23187.1
cDNA Size:2070
cDNA Description:ORF Clone of Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein DNA.
Gene Synonym:EBOV-G
Species:EBOV
Vector:pCMV3-C-FLAG
Restriction Site:KpnI + XbaI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40304-ACG$345
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40304-ACR$345
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40304-ANG$345
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40304-CF$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40304-CH$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40304-CM$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40304-CY$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone)VG40304-G$195
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40304-NF$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40304-NH$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40304-NM$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40304-NY$315
Ebola virus EBOV (subtype Zaire, strain Mayinga 1976) glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40304-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

The fourth gene of the EBOV genome encodes a 160-kDa envelope-attached glycoprotein (GP) and a 110 kDa secreted glycoprotein (sGP). Both GP and sGP have an identical 295-residue N-terminus, however, they have different C-terminal sequences. Recently, great attention has been paid to GP for vaccines design and entry inhibitors isolation. GP is a class I fusion protein which assembles as trimers on viral surface and plays an important role in virus entry and attachment. Mature GP is a disulfide-linked heterodimer formed by two subunits, GP1 and GP2, which are generated from the proteolytical process of GP precursor (pre-GP) by cellular furin during virus assembly . The GP1 subunit contains a mucin domain and a receptor-binding domain (RBD); the GP2 subunit has a fusion peptide, a helical heptad-repeat (HR) region, a transmembrane (TM) domain, and a 4-residue cytoplasmic tail. The RBD of GP1 mediates the interaction of EBOV with cellular receptor (e.g. DC-SIGN/LSIGN, TIM-1, hMGL, NPC1, β-integrins, folate receptor-α, and Tyro3 family receptors), of which TIM1 and NPC1 are essential for EBOV entry; the mucin domain having N- and O-linked glycans enhances the viral attachment to cellular hMGL, and participates in shielding key neutralization epitopes, which helps the virus evades immune elimination. There are large conformation changes of GP2 during membrane fusion, which enhance the insertion of fusion loop into cellular membrane and facilitate the release of viral nucleocapsid core to cytoplasm.

References
  1. Volchkov VE, et al. Processing of the Ebola virus glycoprotein by the proprotein convertase furin. Proc Natl Acad Sci U S A. 1998 May 12;95(10):5762-7.
  2. Lee JE, et al. Structure of the Ebola virus glycoprotein bound to an antibody from a human survivor. Nature. 2008 Jul 10;454(7201):177-82. doi: 10.1038/nature07082.
  3. Hood CL, et al. Biochemical and structural characterization of cathepsin L-processed Ebola virus glycoprotein: implications for viral entry and immunogenicity. J Virol. 2010 Mar;84(6):2972-82. doi: 10.1128/JVI.02151-09.
  4. Cook JD and Lee JE. The secret life of viral entry glycoproteins: moonlighting in immune evasion. PLoS Pathog. 2013 May;9(5):e1003258. doi: 10.1371/journal.ppat.1003258.
  5. Miller EH and Chandran K. Filovirus entry into cells - new insights. Curr Opin Virol. 2012 Apr;2(2):206-14. doi: 10.1016/j.coviro.2012.02.015.
Size / Price
Catalog:VG40304-CF
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 Business days
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"