After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse KLK-4 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse KLK4 cDNA Clone Product Information
NCBI RefSeq:NM_019928.1
RefSeq ORF Size:768bp
cDNA Description:Full length Clone DNA of Mus musculus kallikrein related-peptidase 4 with N terminal His tag.
Gene Synonym:PSTS, ESMP1, KLK-L1, Prss17, Klk4
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Kallikrein-4, also known as Enamel matrix serine proteinase 1, Kallikrein-like protein 1, KLK-L1, Serine protease 17, KLK4, PRSS17 and EMSP1, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Kallikrein-4 / KLK4 is a serine protease expressed during enamel maturation, and proteolytic processing of the enamel matrix by KLK4 is critical for proper enamel formation. Kallikrein-4 / KLK4 contains one peptidase S1 domain. Kallikrein-4 / KLK4 is secreted by transition- and maturation-stage ameloblasts. KLK4 aggressively degrades the retained organic matrix following the termination of enamel protein secretion. Two proteases are secreted into the enamel matrix of developing teeth. The early protease is enamelysin (MMP-20). The late protease is kallikrein 4 (KLK4). The principle functions of MMP-20 and KLK4 in dental enamel formation are to facilitate the orderly replacement of organic matrix with mineral, generating an enamel layer that is harder, less porous, and unstained by retained enamel proteins. Defects in Kallikrein-4 / KLK4 are the cause of amelogenesis imperfecta hypomaturation type 2A1 (AI2A1) which is an autosomal recessive defect of enamel formation. The disorder involves both primary and secondary dentitions.

Size / Price
Catalog: MG50993-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"