Quick Order

Text Size:AAA

Mouse CXCL1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCL1cDNA Clone Product Information
cDNA Size:291
cDNA Description:ORF Clone of Mus musculus chemokine (C-X-C motif) ligand 1 DNA.
Gene Synonym:KC, Fsp, N51, gro, Gro1, Mgsa, Scyb1, Cxcl1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Chemokine & Receptor Related Products
Product nameProduct name

The Chemokine (C-X-C motif) Ligand 1, CXCL1, is a small cytokine belonging to the CXC chemokine family that was previously called GRO1 oncogene, GRO?, KC, Neutrophil-activating protein 3 (NAP-3) and melanoma growth stimulating activity, alpha (MSGA-a). CXCL1 already known to be important in osteoarthritis (OA), as a novel target gene of transcription factor AP-2? in chondrocytes and support the important role of AP-2? in cartilage. CXCL1 is a potent neutrophil chemoattractant with recognized roles in angiogenesis and inflammation. CXCL1 is a novel immediate PTH/PTHrP-responsive gene. CXCL1 may act as a chemoattractant for osteoclast precursors. CXCL1 may also have important pro-nociceptive effects via its direct actions on sensory neurons, and may induce long-term changes that involve protein synthesis. CXCL1 plays a critical nonredundant role in the development of experimental Lyme arthritis and carditis via CXCR2-mediated recruitment of neutrophils into the site of infection. CXCL1 functions through CXCR2 to transactivate the EGFR by proteolytic cleavage of HB-EGF, leading to activation of MAPK signalling and increased proliferation of epithelial ovarian cancer (EOC) cells. It might limit tumor growth by reinforcing senescence early in tumorigenesis. Thus, CXCL1 plays a role in spinal cord development by inhibiting the migration of oligodendrocyte precursors and is involved in the processes of angiogenesis, inflammation, wound healing, and tumorigenesis.

  • Wang JG, et al. (2008) The chemokine CXCL1/growth related oncogene increases sodium currents and neuronal excitability in small diameter sensory neurons. Mol Pain. 4: 38.
  • Acosta JC, et al. (2009) A role for CXCR2 in senescence, but what about in cancer? Cancer Res. 69(6): 2167-70.
  • Onan D, et al. (2009) The chemokine Cxcl1 is a novel target gene of parathyroid hormone (PTH)/PTH-related protein in committed osteoblasts. Endocrinology. 150(5): 2244-53.
  • Ritzman AM, et al. (2010) The chemokine receptor CXCR2 ligand KC (CXCL1) mediates neutrophil recruitment and is critical for development of experimental Lyme arthritis and carditis. Infect Immun. 78(11): 4593-600.
  • Bolitho C, et al. (2010) The chemokine CXCL1 induces proliferation in epithelial ovarian cancer cells by transactivation of the epidermal growth factor receptor. Endocr Relat Cancer. 17(4): 929-40.
  • Wenke AK, et al. (2011) The transcription factor AP-2? regulates CXCL1 during cartilage development and in osteoarthritis. Osteoarthritis Cartilage. 19(2): 206-12.