After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TREM2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TREM2cDNA Clone Product Information
Gene_bank_ref_id:NM_031254.2
cDNA Size:684
cDNA Description:ORF Clone of Mus musculus triggering receptor expressed on myeloid cells 2 DNA.
Gene Synonym:Trem2a, Trem2b, Trem2c
Species:Mouse
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

Triggering receptor expressed on myeloid cells 2 ( TREM2 ) is a single Ig domain receptor. It is expressed on macrophages and dendritic cells but not on granulocytes or monocytes. Its expression is most abundant in the basal ganglia, corpus callosum, medulla oblongata and spinal cord, and microglial cells are the major TREM2-producing cell type in the central nervous system (CNS). TREM2 may play a role in chronic inflammations and may stimulate production of constitutive rather than inflammatory chemokines and cytokines. TREM2 forms a receptor signaling complex with TYROBP and triggers activation of the immune responses in macrophages and dendritic cells. It also associates with the signal adapter protein, DAP12, which has a cytoplasmic ITAM, leading to the subsequent activation of cytoplasmic tyrosine kinases. TREM2 is both required and sufficient for competent uptake of apoptotic neuronal cells. TREM2 and TREM2-L form a receptor-ligand pair connecting microglia with apoptotic neurons, directing removal of damaged cells to allow repair. Deficiency of the adapter protein DAP12 or its associated receptor TREM2 is associated with abnormal osteoclast development in humans. Defects in TREM2 are causes of PLOSL, also known as NHD. In addition, TREM2 signaling is also an important pathway to promote healing of wounds in the colon where stem cell replacement is necessary.

References
  • Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.
  • Paloneva, J. et al., 2002, Am. J. Hum. Genet. 71:656-662. 
  • Prada, I. et al., 2006, Neuroscience. 140 (4): 1139-48.
  • Neumann, H. et al., 2007, J Neuroimmunol. 184 (1-2): 92-9.
  • Thrash, JC. et al., 2009, Neurochem Res. 34 (1): 38-45.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"