After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse WIF1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse WIF1 cDNA Clone Product Information
Gene_bank_ref_id:NM_011915.2
RefSeq ORF Size:1140bp
cDNA Description:Full length Clone DNA of Mus musculus Wnt inhibitory factor 1 with N terminal His tag.
Gene Synonym:WIF-1, AW107799, Wif1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

WIF1, also known as WIF-1 and wnt inhibitory factor 1, is a secreted protein which binds WNT proteins and inhibits their activities. It contains a WNT inhibitory factor (WIF) domain and 5 epidermal growth factor (EGF)-like domains. WNT proteins are extracellular signaling molecules involved in the control of embryonic development. WIF1 may be involved in mesoderm segmentation and can be detected in fish, amphibia and mammals. WIF-1 is a recurrent target in human salivary gland oncogenesis. Downregulation of WIF1 takes part in the development and progression of pleomorphic adenomas. WIF1 also is a tumor suppressor, and has been found to be epigenetically silenced in various cancers, specifically in nonfunctioning pituitary tumors. WIF1 are expected to have molecular function (protein tyrosine kinase activity) and to localize in various compartments (extracellular space, extracellular region).

References
  • Shepelev MV, et al. (2006) WIF1: perspectives of application in oncology. Mol Gen Mikrobiol Virusol. (4): 3-7.
  • Lin YC, et al. (2006) Wnt signaling activation and WIF-1 silencing in nasopharyngeal cancer cell lines. Biochem Biophys Res Commun. 341(2):635-40.
  • Queimado L, et al. (2007) WIF1, an inhibitor of the Wnt pathway, is rearranged in salivary gland tumors. Genes Chromosomes Cancer. 46(3):215-25.
  • Size / Price
    Catalog: MG50984-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"