Quick Order

Dengue virus DENV-2 (strain New Guinea C) NS4B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DENV DENV-NS4B cDNA Clone Product Information
Gene_bank_ref_id:AF038403.1
RefSeq ORF Size:744bp
cDNA Description:Full length Clone DNA of DENV-2 (strain New Guinea C) NS4B with C terminal Flag tag.
Gene Synonym:DENV-NS4B
Species:DENV
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence AF038403.1 (6826..7569), corresponding to amino acid sequence AAC59275.1 (aa 2244-2491).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Dengue virus DENV-2 (strain New Guinea C) NS4B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-GFPSpark tagVG40266-ACG$325
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40266-ACR$325
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-GFPSpark tagVG40266-ANG$325
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40266-ANR$325
Dengue virus DENV-2 (strain New Guinea C) NS4B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40266-CF$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-His tagVG40266-CH$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-Myc tagVG40266-CM$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-HA tagVG40266-CY$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid (Codon Optimized)VG40266-G$95
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-Flag tagVG40266-NF$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-His tagVG40266-NH$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-Myc tagVG40266-NM$295
Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-HA tagVG40266-NY$295
Dengue virus DENV-2 (strain New Guinea C) NS4B natural ORF mammalian expression plasmidVG40266-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40266-CF
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"