After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CXCL7 / Ppbp Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PPBPcDNA Clone Product Information
Gene_bank_ref_id:NM_023785.2
cDNA Size:342
cDNA Description:ORF Clone of Mus musculus pro-platelet basic protein DNA.
Gene Synonym:TGB, LDGF, MDGF, TGB1, CTAP3, Cxcl7, NAP-2, Scyb7, b-TG1, LA-PF4, THBGB1, CTAPIII, beta-TG, AI854500, NAP-2-L1, 2400003M24Rik, Ppbp
Species:Mouse
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Chemokine & Receptor Related Products
Product nameProduct name
Background

Pro-platelet basic protein (PPBP) is also known as Chemokine (C-X-C motif) ligand 7 (CXCL7) and nucleosome assembly protein (Nap-2). Nap-2 / PPBP / CXCL7 is released in large amounts from platelets following their activation and is a platelet-derived growth factor that belongs to the CXC chemokine family. This growth factor is a potent chemoattractant and activator of neutrophils. Nap-2 / PPBP / CXCL7 has been shown to stimulate various cellular processes including DNA synthesis, mitosis, glycolysis, intracellular cAMP accumulation, prostaglandin E2 secretion, and synthesis of hyaluronic acid and sulfated glycosaminoglycan. It also stimulates the formation and secretion of plasminogen activator by synovial cells. Nap-2 is a ligand for CXCR1 and CXCR2, and Nap-2, Nap-2 (73), Nap-2 (74), Nap-2 (1-66), and most potent Nap-2 (1-63) are chemoattractants and activators for neutrophils.

References
  • Walz A, et al. (1989) Effects of the neutrophil-activating peptide NAP-2, platelet basic protein, connective tissue-activating peptide III and platelet factor 4 on human neutrophils. J Exp Med. 170(5):1745-50.
  • Walz A, et al. (1990) Generation of the neutrophil-activating peptide NAP-2 from platelet basic protein or connective tissue-activating peptide III through monocyte proteases. J Exp Med. 171(2): 449-54.
  • Loetscher P, et al. (1994) Both interleukin-8 receptors independently mediate chemotaxis. Jurkat cells transfected with IL-8R1 or IL-8R2 migrate in response to IL-8, GRO alpha and NAP-2. FEBS Lett. 341(2-3): 187-92.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"