After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse KLK-8 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse KLK8 cDNA Clone Product Information
NCBI RefSeq:NM_008940.2
RefSeq ORF Size:783bp
cDNA Description:Full length Clone DNA of Mus musculus kallikrein related-peptidase 8 with N terminal His tag.
Gene Synonym:BSP1, Nrpn, Prss19, Klk8
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Kallikrein-8, also known as Neuropsin, Serine protease 19, Serine protease TADG-14, Tumor-associated differentially expressed gene 14 protein and KLK8, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. It is a serine protease which is capable of degrading a number of proteins such as casein, fibrinogen, kininogen, fibronectin and collagen type IV. Kallikrein-8 / KLK8 plays a role in the formation and maturation of orphan and small synaptic boutons in the Schaffer-collateral pathway. It regulates Schaffer-collateral long-term potentiation in the hippocampus and is required for memory acquisition and synaptic plasticity. It is involved in skin desquamation and keratinocyte proliferation and plays a role in the secondary phase of pathogenesis following spinal cord injury. It also cleaves L1CAM in response to increased neural activity. It induces neurite outgrowth and fasciculation of cultured hippocampal neurons. Kallikrein-8 / KLK8 is expressed at high levels in serum, ascites fluid and tumor cytosol of advanced stage ovarian cancer patients and may serve as a marker of ovarian cancer. Kallikrein-8 / KLK8 may have potential clinical value for disease diagnosis or prognosis and it may also be a useful therapeutic target.

Size / Price
Catalog: MG50967-NH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"