Quick Order

Mouse CTSD ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CTSD cDNA Clone Product Information
Gene_bank_ref_id:NM_009983.2
RefSeq ORF Size:1233bp
cDNA Description:Full length Clone DNA of Mus musculus cathepsin D with C terminal HA tag.
Gene Synonym:CD, CatD, Ctsd
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Cathepsin D (CTSD), a well known lysosomal aspartyl protease and belongs to the peptidase C1 family, which is a normal and major component of lysosomes, and is found in almost all cells and tissues of mammals. Its mostly described function is intracellular catabolism in lysosomal compartments, other physiological effect include hormone and antigen processing. Cathepsin D has a specificity similar to but narrower than that of pepsin A. Cathepsin D plays an important role in the degradation of proteins, the generation of bioactive proteins, antigen processing, etc. Among different role in cell physiology, a new function of this enzyme is examined. Cathepsin D is an important regulator of apoptotic pathways in cells. It acts at different stage of intrinsic and extrinsic pathway of apoptosis. In addition, CTSD secreted from human prostate carcinoma cells are responsible for the generation of angiostatin, a potent endogenous inhibitor of angiogenesis, suggesting its contribution to the prevention of tumor growth and angiogenesis-dependent growth of metastases.

References
  • Fusek M, et al. (2005) Dual role of cathepsin D: ligand and protease. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 149(1): 43-50.
  • Minarowska A, et al. (2007) Regulatory role of cathepsin D in apoptosis. Folia Histochem Cytobiol. 45(3): 159-63.
  • Zaidi N, et al. (2008) Cathepsin D: a cellular roadmap. Biochem Biophys Res Commun. 376(1): 5-9.
  • Size / Price
    Catalog: MG50127-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"