Quick Order

Text Size:AAA

Rat GpT2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat GPT2 cDNA Clone Product Information
Gene_bank_ref_id:NM_001012057.1
RefSeq ORF Size:1569bp
cDNA Description:Full length Clone DNA of Rattus norvegicus glutamic pyruvate transaminase (alanine aminotransferase) 2 with N terminal Myc tag.
Gene Synonym:ALT2, Cc2-5, Gpt2
Species:Rat
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Alanine aminotransferase (ALT), also known as glutamate pyruvate transaminase (Gpt), is a pyridoxal enzyme which catalyses the reversible interconversion of L-alanine and 2-oxoglutalate to pyruvate and L-glutamate, and plays a key role in the intermediary metabolism of glucose and amino acids. As a key enzyme for gluconeogenesis, Gpt is a widely-used serum marker for liver injury. Two ALT isoenzymes have been identified, ALT1 and ALT2 (GPT1 and GPT2), which are encoded by separate genes and share significant sequence homology, but differ in their expression patterns. Gpt1 is widely distributed and mainly expressed in intestine, liver, fat tissues, colon, muscle, and heart, in the order of high to low expression level, whereas Gpt2 expression is more restricted, mainly in liver, muscle, brain, and white adipose tissue. It has been reported that hepatic ALT2 protein is approximately four times higher in male rats than in female rats.

References
  • Matthews, C.C. et al., 2002, Genomics. 79: 445-450.
  • Jadhao, S.B. et al., 2004, Hepatology. 39: 1297-1302.
  • Schindhelm, R.K. et al., 2005, Eur. J.Clin. Invest. 35:369-374.
  • Lindblom, P. et al., 2007, Arch Biochem Biophys. 466 (1): 66-77.
  • Liu, L.et al., 2008, Protein Expr Purif. 60 (2): 225-231.
  • Yang, R. Z. et al., 2009, Hepatology. 49 (2): 598-607.
  • Size / Price
    Catalog: RG80002-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"