Quick Order

Mouse SPINK4 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse SPINK4 cDNA Clone Product Information
Gene_bank_ref_id:NM_011463.2
RefSeq ORF Size:261bp
cDNA Description:Full length Clone DNA of Mus musculus serine peptidase inhibitor, Kazal type 4 with N terminal His tag.
Gene Synonym:MPGC60, Spink4
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Serine protease inhibitor Kazal-type 4, also known as Peptide PEC-60 homolog and SPINK4, is a secreted protein which contains one Kazal-like domain. SPINK4 is a member of the SPINK protein family. The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). SPINK1 plays an important role in protecting the pancreas against excessive trypsinogen activation. It is a potent natural inhibitor of pancreatic trypsin activity. SPINK1 mutations are associated with the development of acute and chronic pancreatitis and have been detected in all forms of chronic pancreatitis. SPINK2 functions as a trypsin/acrosin inhibitor and is synthesized mainly in the testis and seminal vesicle where its activity is engaged in fertility. The SPINK2 protein contains a typical Kazal domain composed by six cysteine residues forming three disulfide bridges. SPINK9 was identified in human skin. Its expression was strong in palmar epidermis, but not detectable or very low in non palmoplantar skin.

References
  • Schneider, A. et al., 2004,Gastroenterol Clin North Am. 33 (4): 789-806.
  • Wapenaar, MC. et al., 2007, Immunogenetics. 59 (5): 349-57.
  • Brattsand, M. et al., 2009, J Invest Dermatol. 129 (7): 1656-65.
  • Chen, T. et al., 2009, Proteins. 77 (1): 209-19.
  • Noah, TK. et al., 2010, Exp Cell Res. 316 (3): 452-65.
  • Size / Price
    Catalog: MG50953-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"