After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse VNN1 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse VNN1 cDNA Clone Product Information
Gene_bank_ref_id:NM_011704.3
RefSeq ORF Size:1539bp
cDNA Description:Full length Clone DNA of Mus musculus vanin 1 with N terminal His tag.
Gene Synonym:V-1, Vnn1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Pantetheinase, also known as Pantetheine hydrolase, Vascular non-inflammatory molecule 1, Vanin-1, and VNN1, is a cell membrane protein which belongs to the CN hydrolase family and BTD/VNN subfamily. Vanin-1 contains one CN hydrolase domain. It is widely expressed with higher expression in spleen, kidney and blood. It is overexpressed in lesional psoriatic skin. Vanin-1 is also a member of the Vanin family of proteins which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. Vanin-1 is an epithelial pantetheinase that provides cysteamine to tissue and regulates response to stress. Vanin-1 is expressed by enterocytes, and its absence limits intestinal epithelial cell production of proinflammatory signals. Vanin-1 regulates late adhesion steps of thymus homing under physiological, noninflammatory conditions. The early impact of vanin-1 deficiency on tumor induction was directly correlated to the amount of inflammation and subsequent epithelial proliferation rather than cell death rate. Vanin-1 molecule was shown to be involved in the control of thymus reconstitution following sublethal irradiation.

References
  • Aurrand-Lions M, et al. (1996) Vanin-1, a Novel GPI-Linked Perivascular Molecule Involved in Thymus Homing. Immunity. 5 (5): 391-405.
  • Grimmond S, et al. (2000) Sexually dimorphic expression of protease nexin-1 and vanin-1 in the developing mouse gonad prior to overt differentiation suggests a role in mammalian sexual development. Hum Mol Genet. 9 (10): 1553-60.
  • Meghari S, et al. (2007) Vanin-1 controls granuloma formation and macrophage polarization in Coxiella burnetii infection. Eur J Immunol. 37 (1): 24-32.
  • Size / Price
    Catalog: MG50952-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"