Quick Order

Text Size:AAA

Mouse FAM3D ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse FAM3D cDNA Clone Product Information
Gene_bank_ref_id:NM_146050.2
RefSeq ORF Size:672bp
cDNA Description:Full length Clone DNA of Mus musculus oncoprotein induced transcript 1 with N terminal His tag.
Gene Synonym:EF-7, Fam3d, AV067083, MGC37550, 2310076N21Rik, Oit1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Family with sequence similarity 3 (FAM3) family is a novel cytokine-like gene family, which has four genes in this family, FAM3A, FAM3B, FAM3C, and FAM3D, each encoding a protein (224-235 amino acids) with a hydrophobic leader sequence. It had indicated that FAM3B/PANDER (pancreatic derived factor) is highly expressed in pancreas, and FAM3A and FAM3C in almost all tissues. FAM3D is abundantly expressed in placenta and weakly expressed in small intestine. Immunohistochemistry showed that FAM3A is expressed prominently in the vascular endothelium, particularly capillaries. FAM3A and FAM3B protein were both localized to the islets of Langerhans of the endocrine pancreas. Recombinant FAM3B protein has delayed effects on beta-cell function. FAM3C is involved in retinal laminar formation processes in vertebrates. NFATC2, SCP2, CACNA1C, TCRA, POLE, and FAM3D, were associated with narcolepsy. Some of these associations were further supported by gene expression analyses and an association study in essential hypersomnia (EHS), CNS hypersonia similar to narcolepsy.

References
  • Zhu Y, et al. (2002) Cloning, expression, and initial characterization of a novel cytokine-like gene family. Genomics. 80(2): 144-50.
  • Katahira T, et al. (2010) Secreted factor FAM3C (ILEI) is involved in retinal laminar formation. Biochem Biophys Res Commun. 392(3): 301-6.
  • Shimada M, et al. (2010) An approach based on a genome-wide association study reveals candidate loci for narcolepsy. Hum Genet. 128(4): 433-41.
  • Size / Price
    Catalog: MG50951-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"