Quick Order

Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NS1cDNA Clone Product Information
Gene_bank_ref_id:AF389122.1
cDNA Size:693
cDNA Description:ORF Clone of Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 DNA.
Gene Synonym:NS1
Species:H1N1
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged on other vectors
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40011-ACG$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40011-ACR$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40011-ANG$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40011-ANR$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40011-CF$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40011-CH$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40011-CM$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40011-CY$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone)VG40011-M$95
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone) expression ready, His-taggedVG40011-M-H$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40011-NF$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40011-NH$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40011-NM$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40011-NY$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40011-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

The NS1 Influenza protein is created by the internal protein encoding, linear negative-sense, single stranded RNA, NS gene segment and which also codes for the nuclear export protein or NEP, formerly referred to as the NS2 protein, which mediates the export of vRNPs. The non-structural (NS1) protein is found in Influenza virus A, Influenza virus B and Influenza virus C. The non-structural (NS1) protein of the highly pathogenic avian H5N1 viruses circulating in poultry and waterfowl in Southeast Asia is currently believed to be responsible for the enhanced virulence of the strain. Non-structural (NS1) protein of influenza A viruses is a non-essential virulence factor that has multiple accessory functions during viral infection. The major role ascribed to NS1 has been its inhibition of host immune responses, especially the limitation of both interferon (IFN) production and the antiviral effects of IFN-induced proteins, such as dsRNA-dependent protein kinase R (PKR) and 2'5'-oligoadenylate synthetase (OAS)/RNase L. Non-structural (NS1) protein is a non-structural protein of the influenza A virus, which could only be expressed when cells are infected. The effect of NS1 protein on host cell is still not clear. Not only could NS1 remarkably affect metabolism, but it could also slow down cell proliferation through blocking cell cycle. Non-structural (NS1) protein may lead to the development of novel antiviral drugs, and the use of oncolytic influenza A viruses as potential anti-cancer agents.

References
  • Enami,M. et al., 1997, Nippon Rinsho. 55 (10):2605-9.
  • Bergmann,M. et al., 2000, J Virol. 74 (13):6203-6.
  • Hale,B.G. et al., 2008, J Gen Virol. 89 (Pt 10):2359-76.
  • Zhao,L. et al., 2008, Sheng Wu Gong Cheng Xue Bao. 24 (11):1912-7
  • Size / Price
    Catalog:VG40011-CF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"