Quick Order

Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Flag tag, expression ready

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N1 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1725bp
cDNA Description:Full length Clone DNA of Influenza A H5N1 (A/Duck/Hong Kong/p46/97) HA with C terminal Flag tag.
Gene Synonym:HA1, Hemagglutinin
Species:H5N1
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-H5N1-DH-97-HA-Flag
Restriction Site:HindIII + XbaI (6kb + 1.76kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAF02306.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H5N1 HA Gene Plasmid Map
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmid,C-Flag tag, expression ready
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Flag tag, expression ready on other vectors
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark tag, expression readyVG40001-ACG$345
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40001-ACR$345
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmidVG40001-C$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Flag tag, expression readyVG40001-CF$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-His tag, expression readyVG40001-CH$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Myc tag, expression readyVG40001-CM$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-HA tag, expression readyVG40001-CY$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Flag tagVG40001-NF$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression readyVG40001-NH$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Myc tag, expression readyVG40001-NM$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-HA tag, expression readyVG40001-NY$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmid, expression readyVG40001-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40001-CF
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"