After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TIMP2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TIMP2cDNA Clone Product Information
cDNA Size:663
cDNA Description:ORF Clone of Mus musculus tissue inhibitor of metalloproteinase 2 DNA.
Gene Synonym:Timp-2, D11Bwg1104e, Timp2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Tissue inhibitors of metalloproteinases (TIMP) family are natural inhibitors of the matrix metalloproteinases (MMPs), the zinc enzymes involved in extracellular matrix maintenance and remodeling. The TIMP family encompasses four members (TIMP1-4), and they inhibit most MMPs by forming non-covalent binary complex. TIMP2 is a 22 kDa non N-glycosylated protein expressed by a variety of cell types, and plays a unique role among TIMP family members owing to its functions to regulate cellular responses to growth factors. Findings establish an unexpected, MMP-independent mechanism for TIMP2 inhibition of endothelial cell proliferation in vitro and reveal an important component of the antiangiogenic effect of TIMP2 in vivo. TIMP-2 thus is critical to the maintenance of tissue homeostasis and is involved in the regulation of tumor microenvironment.

  • Stetler-Stevenson, W.G. et al., 1992, Matrix. Suppl.1: 299-306.
  • Stetler-Stevenson, W.G. et al., 2005, Trends. Mol. Med. 11: 97-103.
  • Seo, D.W. et al., 2003, Cell. 114: 171-180.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items