Quick Order

Text Size:AAA

Mouse RTN4R / NOGOR ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse RTN4R cDNA Clone Product Information
Gene_bank_ref_id:NM_022982.2
RefSeq ORF Size:1422bp
cDNA Description:Full length Clone DNA of Mus musculus reticulon 4 receptor with C terminal HA tag.
Gene Synonym:NgR, NOGOR
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Reticulon 4 receptor (RTN4R), also known as Nogo-66 Receptor (NgR), is a glycosylphosphoinositol (GPI)-anchored protein that belongs to the Nogo recptor family including three members. Mouse RTN4R cDNA contains 10 LRP (Leucine-rich) repeats. RTN4R is expressed predominantly in neurons and their axons in the central nervous systems (CNS). As a receptor for myelin-derived proteins Nogo, myelin-associated glycoprotein (MAG), and myelin oligodendrocyte glycoprotein (OMG), RTN4R mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult CNS. It has been shown that RTN4R performs its inhibitory actions by interacting with the p75 neurotrophin receptor (p75NTR), a TNFRSF member also known for modulating the activities of the Trk family and for inducing apoptosis in neurons and oligodendrocytes. RTN4R may be proposed as a potential drug target for treatment of various neurological conditions such as spinal cord injury, CNS lesions, peripheral nerve injury, stroke and Alzheimer's disease (AD). Additionally, RTN4R may play a role in regulating the function of the gap junctions.

References

1. Wang, X. et al., 2006, Ann Neurol. 60(5): 540-549.      

2. Wang, Y.Z. et al., 2006, Neuroreport.17(6):605-609.       

3. Zhu, H.Y. et al., 2007, Hum Pathol. 38(3): 426-434.           

4. David, S. et al., 2008, Trends Neurosci. 31(5): 221-226.       

5. Jiang, W. et al., 2009, Transl Res. 154(1): 40-48.      

6. Zhang, L. et al., 2009, J Neurosci, 9(19): 6348-6352.

Size / Price
Catalog: MG50106-CY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"