After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

HIV-1 (group M, CRF07_BC) GP120 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GP120cDNA Clone Product Information
cDNA Size:1560
cDNA Description:ORF Clone of HIV-1 GP120 DNA.
Gene Synonym:gp120
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

HIV-1 (group M, CRF07_BC) GP120 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged  on other vectors
Related Products
Product nameProduct name

The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer layer of the virus, which is an essential component in the multi-tiered viral entry process. It presents itself as viral membrane spikes consisting of 3 molecules of gp120 linked together and anchored to the membrane by gp41 protein. Gp120 is essential for viral infection as it facilitates HIV entry into the host cell and this is its best-known and most researched role in HIV infection. However, it is becoming increasingly evident that gp120 might also be facilitating viral persistence and continuing HIV infection by influencing the T cell immune response to the virus. The surface protein gp120 attaches the virus to the host lymphoid cell by binding to the primary receptor CD4. Gp120 binding to its receptor CD4 and co-receptor, CXCR4 or CCR5 is required for fusion of viral and cellular membranes. Several mechanisms might be involved in this process of which gp120 binding to the CD4 receptor of T cells is the best known and most important interaction as it facilitates viral entry into the CD4+ cells and their depletion, a hallmark of the HIV infection. Gp120 is shed from the viral membrane and accumulates in lymphoid tissues in significant amounts. Despite the overall genetic heterogeneity of the gp120 glycoprotein, the conserved CD4 binding site provides an attractive antiviral target. Interaction between gp120 and ITGA4/ITGB7 would allow the virus to enter GALT early in the infection, infecting and killing most of GALT's resting CD4+ T-cells. This T-cell depletion is believed to be the major insult to the host immune system leading to AIDS.

  • Kadow J, et al. (2006) Small-molecule HIV-1 gp120 inhibitors to prevent HIV-1 entry: an emerging opportunity for drug development. Curr Opin Investig Drugs. 7(8): 721-6.
  • Stevceva L, et al. (2007) Immune responses to HIV Gp120 that facilitate viral escape. Curr HIV Res. 5(1): 47-54.
  • Yoon V, et al. (2010) The GP120 molecule of HIV-1 and its interaction with T cells. Curr Med Chem. 17(8): 741-9.