Quick Order

Text Size:AAA

Mouse FZD1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FZD1cDNA Clone Product Information
cDNA Size:1929
cDNA Description:ORF Clone of Mus musculus frizzled homolog 1 (Drosophila) DNA.
Gene Synonym:FZ-1, AW227548, Fzd1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Wnt Receptor Related Products

Frizzled-1, also known as FZD1, belongs to the G-protein coupled receptor Fz/Smo family. FZD1 contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. FZD1 is expressed in adult heart, placenta, lung, kidney, pancreas, prostate, and ovary and in fetal lung and kidney. Frizzled is a family of G protein-coupled receptor proteins that serve as receptors in the Wnt signaling pathway and other signaling pathways. When activated, Frizzled leads to activation of Dishevelled in the cytosol. Frizzled proteins and the genes encoding them have been identified in an array of animals, from sponges to humans. Frizzled proteins play key roles in governing cell polarity, embryonic development, formation of neural synapses, cell proliferation, and many other processes in developing and adult organisms. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items