Quick Order

Mouse KLK-7 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KLK7cDNA Clone Product Information
Gene_bank_ref_id:NM_011872.2
cDNA Size:750
cDNA Description:ORF Clone of Mus musculus kallikrein related-peptidase 7 (chymotryptic, stratum corneum) DNA.
Gene Synonym:SCCE, Prss6, Klk7
Species:Mouse
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Kallikrein-7, also known as kallikrein-related peptidase 7, Stratum corneum chymotryptic enzyme, Serine protease 6, KLK7, and PRSS6, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Members of the Kallikrein family are involved in various malignancies such as prostate (PSA, KLK2, KLK15), ovarian (KLK4, KLK5, KLK6, KLK8, KLK10), and breast cancer (KLK10, KLK13, KLK14). Kallikrein-7 / KLK7 appears to be increased in ovarian cancer and higher KLK7 expression in ovarian cancer tissue is associated with poorer prognosis of ovarian cancer patients. Kallikrein-7 / KLK7 is abundantly expressed in the skin and is expressed by keratinocytes in the epidermis. Kallikrein-7 / KLK7 is up-regulated in ovarian carcinoma, especially late-stage serous carcinoma, compared with normal ovaries and benign adenomas (at the protein level). It was significantly associated with shorter overall survival (OS) and disease-free survival (DFS). Kallikrein-7 / KLK7 may catalyze the degradation of intercellular cohesive structures in the cornified layer of the skin in the continuous shedding of cells from the skin surface. KLK7 also plays a role in the activation of precursors to inflammatory cytokines.

Size / Price
Catalog:MG50921-NH
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"