Quick Order

Rabbit CANX Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CANXcDNA Clone Product Information
Gene_bank_ref_id:XM_002721303.1
cDNA Size:1782
cDNA Description:ORF Clone of Rabbit calnexin DNA.
Gene Synonym:CANX
Species:Rabbit
Vector:pCMV3-C-FLAG
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
 
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name
Background

Calnexin is a calcium-binding protein that belongs to the calreticulin family. It interacts with newly synthesized glycoproteins in the endoplasmic reticulum. Calnexin seems to play a major role in the quality control apparatus of the ER by the retention of incorrectly folded proteins. It may act in assisting protein assembly and/or in the retention within the ER of unassembled protein subunits. Associated with partial T-cell antigen receptor complexes that escape the ER of immature thymocytes, it may function as a signaling complex regulating thymocyte maturation. Additionally it may play a role in receptor-mediated endocytosis at the synapse.

References
  • Rajagopalan S, et al. (1994) Retention of unassembled components of integral membrane proteins by Calnexin(CANX). Science. 263(5145):387-90.
  • Lenter M, et al. (1994) The integrin chains beta 1 and alpha 6 associate with the chaperone Calnexin(CANX) prior to integrin assembly. J Biol Chem. 269(16):12263-8.
  • Pind S, et al. (1994) Retention of unassembled components of integral membrane proteins by Calnexin(CANX). Science. 263(5145):387-90.
  • Size / Price
    Catalog:TG65135-CF
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"