After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CAT ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CAT cDNA Clone Product Information
Gene_bank_ref_id:NM_009804.2
RefSeq ORF Size:1584bp
cDNA Description:Full length Clone DNA of Mus musculus catalase with C terminal His tag.
Gene Synonym:Cas1, Cs-1, Cas-1, 2210418N07
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Catalase is a ubiquitously expressed enzyme that catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a tetramer of four polypeptides chains containing four porphyrin heme groups that allow the enzyme to react with the hydrogen peroxide. The optimum PH of human catalase is approximately 7 and the optimum temperature is at 37 degree. Both the PH optimum and temperature for other catalases varies depending on the species. Catalase can be inhibited by a flux of O2- generated in situ by the aerobic xanthine oxidase reaction. This inhibition of catalase by O2- provides the basis for a synergism between superoxide dismutase and catalase.Such synergisms have been observed in vitro and may be significant in vivo. Catalase is used in the food industry for removing hydrogen peroxide from milk prior to cheese production. Another use is in food wrappers where it prevents food from oxidizing. Catalase is also used in the textile industry, removing hydrogen peroxide from fabrics to make sure the material is peroxide-free.

References
  • Schriner SE. et al., 2005, Science. 308 (5730): 1909-11.
  • Kono Y. et al., 1982, The Journal of Biological Chemistry. 257: 5751-4.
  • Size / Price
    Catalog: MG51898-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"