After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse CTSB Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CTSBcDNA Clone Product Information
cDNA Size:1020
cDNA Description:ORF Clone of Mus musculus cathepsin B DNA.
Gene Synonym:Ctsb
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Cathepsin B is a papain-family cysteine protease that is normally located in lysosomes, where it is involved in the turnover of proteins and plays various roles in maintaining the normal metabolism of cells. This protease has been implicated in pathological conditions, e.g., tumor progression and arthritis. In disease conditions, increases in the expression of cathepsin B occur at both the gene and protein levels. Cathepsin B is synthesized as a preproenzyme and the primary pathways for its normal trafficking to the lysosome utilize mannose 6-phosphate receptors (MPRs). Mature cathepsin B has the ability to degrade several extracellular matrix components at both neutral and acidic pH and has been implicated in the progression of several human and rodent tumors progression and arthritis. Cathepsin B expression is increased in many human cancers at the mRNA, protein and activity levels. It is also frequently overexpressed in premalignant lesions, an observation that associates this protease with local invasive stages of cancer. Increased expression of cathepsin B in primary cancers, and especially in preneoplastic lesions, suggests that this enzyme might have pro-apoptotic features. Active cathepsin B is also secreted from tumours, a mechanism likely to be facilitated by lysosomal exocytosis or extracellular processing by surface activators. Cathepsin B is localized to caveolae on the tumour surface, where binding to the annexin II heterotetramer occurs. Thus CTSB is suggested as a tumor marker. Additionally, Cathepsin B can degrade extracellular matrix proteins, such as collagen IV and laminin, and can activate the precursor form of urokinase plasminogen activator (uPA), perhaps thereby initiating an extracellular proteolytic cascade.

  • Mai J, et al. (2000) Cell surface complex of cathepsin B/annexin II tetramer in malignant progression. Biochim Biophys Acta. 1477(1-2): 215-30.
  • Podgorski I, et al. (2003) Cathepsin B and its role(s) in cancer progression. Biochem Soc Symp. (70): 263-76.
  • Yan S, et al. (2003) Molecular regulation of human cathepsin B: implication in pathologies. Biol Chem. 384(6): 845-54.
  • Roshy S, et al. (2003) Pericellular cathepsin B and malignant progression. Cancer Metastasis Rev. 22(2-3): 271-86.

    Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items