Quick Order

Text Size:AAA

Mouse PARK7 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PARK7cDNA Clone Product Information
cDNA Size:570
cDNA Description:ORF Clone of Mus musculus Parkinson disease (autosomal recessive, early onset) 7 DNA.
Gene Synonym:Dj1, DJ-1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Parkinson's disease locus DJ-1 (PARK7) is a differentially expressed transcript. DJ-1 plays a physiologic role in protection of erythroid cells from oxidant damage, a function unmasked in the context of oxidative stress. PARK7 belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Mutations in the DJ-1 gene are associated with rare forms of autosomal recessive early-onset Parkinson's disease (PD). DJ-1/p53 interactions contribute to apoptosis resistance in clonal myeloid cells and may serve as a prognostic marker in patients with myelodysplastic syndromes (MDS). DJ-1 regulates redox signaling kinase pathways and acts as a transcriptional regulator of antioxidative gene batteries. Therefore, DJ-1 is an important redox-reactive signaling intermediate controlling oxidative stress after ischemia, upon neuroinflammation, and during age-related neurodegenerative processes. Augmenting DJ-1 activity might provide novel approaches to treating chronic neurodegenerative illnesses such as Parkinson's disease and acute damage such as stroke.

  • Takahashi K, et al. (2001). DJ-1 positively regulates the androgen receptor by impairing the binding of PIASx alpha to the receptor. J. Biol. Chem. (United States). 276 (40): 37556-63.
  • Niki, Takeshi, et al. (2003). DJBP: a novel DJ-1-binding protein, negatively regulates the androgen receptor by recruiting histone deacetylase complex, and DJ-1 antagonizes this inhibition by abrogation of this complex. Mol. Cancer Res. (United States). 1 (4): 247-61.
  • Kahle PJ, et al. (2009) DJ-1 and prevention of oxidative stress in Parkinson's disease and other age-related disorders. Free Radic Biol Med. 47(10): 1354-61.
  • Xu X, et al. (2010) The familial Parkinson's disease gene DJ-1 (PARK7) is expressed in red cells and plays a role in protection against oxidative damage. Blood Cells Mol Dis. 45(3): 227-32.
  • Marcondes AM, et al. (2010) Identification of DJ-1/PARK-7 as a determinant of stroma-dependent and TNF-alpha-induced apoptosis in MDS using mass spectrometry and phosphopeptide analysis. Blood. 115(10): 1993-2002.