After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rabbit S100B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100BcDNA Clone Product Information
cDNA Size:279
cDNA Description:ORF Clone of Rabbit S100 calcium binding protein B DNA.
Gene Synonym:S100B
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-FLAG Vector Information
Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-FLAG Physical Map
Schematic of pCMV3-C-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

S100B is a member of the S100 family of proteins containing two EF-hand-type calcium-binding motifs. S100B exerts both intracellular and extracellular functions. Intracellular S100B acts as a stimulator of cell proliferation and migration and an inhibitor of apoptosis and differentiation, which might have important implications during brain, cartilage and skeletal muscle development and repair, activation of astrocytes in the course of brain damage and neurodegenerative processes, and of cardiomyocyte remodeling after infarction, as well as in melanomagenesis and gliomagenesis. As an extracellular factor, S100B engages RAGE (receptor for advanced glycation end products) in a variety of cell types with different outcomes (i.e. beneficial or detrimental, pro-proliferative or pro-differentiative) depending on the concentration attained by the protein, the cell type and the microenvironment. This calcium binding astrocyte-specific cytokine, presents a marker of astrocytic activation and reflects CNS injury. The excellent sensitivity of S100B has enabled it to confirm the existence of subtle brain injury in patients with mild head trauma, strokes, and after successful resuscitation from cardiopulmonary arrest. Recent findings provide evidence, that S100B may decrease neuronal injury and/or contribute to repair following traumatic brain injury (TBI). Hence, S100B, far from being a negative determinant of outcome, as suggested previously in the human TBI and ischemia literature, is of potential therapeutic value that could improve outcome in patients who sustain various forms of acute brain damage.

  • Kleindienst A, et al. (2006) A critical analysis of the role of the neurotrophic protein S100B in acute brain injury. J Neurotrauma. 23(8): 1185-200.
  • Bloomfield SM, et al. (2007) Reliability of S100B in predicting severity of central nervous system injury. Neurocrit Care. 6(2): 121-38.
  • Donato R, et al. (2009) S100B's double life: intracellular regulator and extracellular signal. Biochim Biophys Acta. 1793(6): 1008-22.
  • Beaudeux JL. (2009) S100B protein: a novel biomarker for the diagnosis of head injury. Ann Pharm Fr. Beaudeux JL. 67(3): 187-94.