Quick Order

Mouse CD62L / SELL Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SELLcDNA Clone Product Information
cDNA Size:1119
cDNA Description:ORF Clone of Mus musculus selectin, lymphocyte DNA.
Gene Synonym:Lnhr, CD62L, Ly-22, Lyam1, Ly-m22, Lyam-1, LECAM-1, AI528707, L-selectin, Sell
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

L-selectin (SELL), also known as CD62L, is a key adhesion molecule that regulates both the migration of leukocytes at sites of inflammation and the recirculation of lymphocytes between blood and lymphoid tissues. It belongs to the selectin family of proteins, and consisting of a large, highly glycosylated, extracellular domain, a single spanning transmembrane domain and a small cytoplasmic tail. L-selectin is the only selectin expressed on leukocytes and mediates a number of leukocyte-endothelial interactions. L-selectin acts as a "homing receptor" for leukocytes to enter secondary lymphoid tissues via high endothelial venules. Ligands present on endothelial cells will bind to leukocyte expressing L-selectin, slowing leukocyte trafficking through the blood, and facilitating entry into a secondary lymphoid organ at that point. L-selectin-mediated lymphocyte recirculation is required for maintaining the appropriate tissue distribution of lymphocyte subpopulations including naïve and effector subsets such as regulatory T cells. In addition, L-selectin-mediated entry into peripheral lymph nodes is required for optimal induction of lymphocyte homeostatic proliferation during lymphopenia. Importantly, L-selectin has been shown to have both adhesive and signaling functions during leukocyte migration. L-selectin has also been shown to mediate leukocyte recruitment during chronic inflammatory and autoimmune diseases and thus is a potential therapeutic target for drug development.

  • Smalley DM, et al. (2005) L-selectin: mechanisms and physiological significance of ectodomain cleavage. J Cell Mol Med. 9(2): 255-66.
  • Grailer JJ, et al. (2009) L-selectin: role in regulating homeostasis and cutaneous inflammation. J Dermatol Sci. 56(3): 141-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items