Quick Order

Text Size:AAA

Mouse ADAM9 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ADAM9 cDNA Clone Product Information
Gene_bank_ref_id:NM_007404.2
RefSeq ORF Size:2538bp
cDNA Description:Full length Clone DNA of Mus musculus a disintegrin and metallopeptidase domain 9 (meltrin gamma) with C terminal HA tag.
Gene Synonym:MDC9, Mltng, AU020942, mKIAA0021, Adam9
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:pCMV3-mADAM9-HA
Restriction Site:KpnI + NotI (6kb + 2.59kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

ADAM9 (A disintegrin and metallopeptidase domain 9, MDC9, meltrin gamma), is a type 1 transmembrane protein that has been associated with cancer development and metastases. ADAM9 is consistently overexpressed in various human cancers, and plays a role in tumorigenesis in mouse models. ADAM9 cleaves and releases a number of molecules with important roles in tumorigenesis and angiogenesis, such as EGF, FGFR2iiib, Tie-2, Flk-1, EphB4, CD40, VCAM-1, and VE-cadherin, and could represent a potential therapeutic target in tumors where it is highly expressed. ADAM9 belongs to a family of transmembrane, disintegrin-containing metalloproteinases involved in protein ectodomain shedding and cell-cell and cell-matrix interactions. ADAM-9 adhesive domain plays a role in regulating the motility of cells by interaction with beta1 integrins and modulates MMP synthesis.

References
  • Caltabiano R, et al. (2011) ADAM-9 expression in intestinal-type adenocarcinoma of the sinonasal tract. Appl Immunohistochem Mol Morphol. 19(3): 283-7.
  • Peduto L. (2009) ADAM9 as a potential target molecule in cancer. Curr Pharm Des. 15(20): 2282-7.
  • Zigrino P, et al. (2007) Role of ADAM-9 disintegrin-cysteine-rich domains in human keratinocyte migration. J Biol Chem. 282(42): 30785-93.
  • Size / Price
    Catalog: MG50044-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"