Quick Order

Mouse PROCR Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PROCRcDNA Clone Product Information
cDNA Size:729
cDNA Description:ORF Clone of Mus musculus protein C receptor, endothelial DNA.
Gene Synonym:Ccca, Epcr, Ccd41, AI325044, Procr
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Endothelial protein C receptor (EPCR), also known as activated protein C receptor (APC receptor) or PROCR, is a receptor for Protein C. Protein C plays an important role in many metabolism processes in humans and other animals after activated by binding to Endothelial protein C receptor (EPCR). Because of the EPCR is found primarily on endothelial cells (cells on the inside of blood vessels), activated protein C is found maily near endothelial cells. Protein C is pleiotropic, with two main functions: anticoagulation and cytoprotection. Which function will be performed depend on whether or not protein C remains bind to EPCR after activated. The anticoagulation occurs when it does not. In this case, protein C functions as an anticoagulant by irreversibly proteolytically inactivating Factor Va and Factor VIIIa, turning them into Factor Vi and Factor VIIIi respectively. When still bound to EPCR, activated protein C performs its cytoprotective effects, acting on the effector substrate PAR-1, protease-activated receptor-1. To a degree, APC's anticoagulant properties are independent of its cytoprotective ones, in that expression of one pathway is not affected by the existence of the other. 

  • Nicolaes GA, et al. (2003). Congenital and acquired activated protein C resistance. Semin Vasc Med. 3 (1): 33-46.
  • Esmon CT. ( 2003). The protein C pathway. Chest 124 (3): 26-32.
  • Mosnier LO, et al. (2007)The cytoprotective protein C pathway. Blood. 109: 3161-72.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items