After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Hgfac Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HGFAcDNA Clone Product Information
cDNA Size:1962
cDNA Description:ORF Clone of Mus musculus hepatocyte growth factor activator DNA.
Gene Synonym:HGFA, Hgfac
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

HGF activator (HGFA) is a serum-derived serine protease and belongs to the peptidase family S1.HGFA is responsible for the conversion of hepatocyte growth factor (HGF), from the inactive single-chain precursor to the active heterodimeric form, which is a potent mitogen, motogen, and morphogen for liver cells, epithelial cells, and endothelial cells. HGFA is synthesized and secreted by the liver and circulates in the plasma as an inactive single-chain zymogen in normal states. The zymogen is cleaved by thrombin or thermolysin through the endoproteolytic process and forms an active heterodimer linked by a disulfide bond. In turn, the active protease can be inhibited by HGFA inhibitors (HAIs) including HAI-1 and HAI-2. In addition, the HGFA zymogen acquires a strong affinity upon activation and thus may ensure the local action in tissue regeneration in liver, kidney and skin. It has been reported that activation of HGF is a critical limiting step in the HGF/SF-induced signaling pathway mediated by Met, and accordingly, aberrant expression of HGFA is implicated in tumorigenesis and progression.


1.  Shimomura, T. et al., 1993, J. Biol. Chem. 268: 22927-22932.

2.  Miyazawa, K. et al., 1996, J. Biol. Chem. 271 : 3615-3618.

3.  Shia, S. et al., 2005, J. Mol. Biol. 346: 1335-1349.

4.  Kataoka, H. et al., 2000, J. Biol. Chem. 275: 40453-40462.

5.  Tjin, E.P. et al., 2006, Blood. 107: 760-768.

6.  Kitajima, Y. et al., 2000, Cancer. Res. 60: 6148-6159.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items